The goal of our detector was to reveal the presence of Vibrio cholerae in a sample. The design of this detector has been inspired by Cork Ireland 2015 team : they created different detectors based on the perfect complementarity of the double strand DNA.
Thus, we - Grenoble team 2017 - decided to create a similar detector for cholera’s pathogen.

A. Bioinformatics Part

A.1 Choice of the target

The bioinformatic work aimed to find a specific Vibrio cholerae sequence to detect.
We started by studying the Vibrio cholerae (Vc) pathogenicity. We focused on the known epidemic strains O1 (GeneBank : KF664566.1) and O139 (AF302794.1) sequences available on PubMed. Importantly, Vc’s pathogenicity is premised on the integration of a bacteriophage sequence - bacteriophage CTX - in Vc’s genome. Indeed, the integrated sequence contains gene for toxins. We decided to target a part of CTX’s genome based on the actual knowledge (B.M. David and M.K. Waldor, Filamentous phages linked to virulence of Vibrio Cholerae, Current Opinion in Microbiology, 2003 Feb, 6(1):35-42).
CTX insert different genes. The most famous are CTXA and CTXB, for which parallel transcription leads to the production of a cholera’s toxin, responsible for symptoms of cholera disease. However, there are other genes with other role in CTX life cycle. To choose the target, we focused on non-pathogenic genes (for instance: genes which have a role in the reproduction of the bacteriophage or its metabolism).
One of our requirements was to detect a target which is specific. After a blast of all CTX’s genes, we decided to work on genes which have low similarity with other organisms. Blast displayed lot of genes specific to Vibrio cholerae and bacteriophage CTX.
Then we needed the target to be quite small (less than 100bp) and cut with a single enzyme (ideally blunt end).
Finally, the target was found in RstA gene (1080bp) from bacteriophage CTX. The target is located between nucleotide 726 and nucleotide 765.

Target : 5’-CTTGGTTTAGATATGCACTGGTTTCGTAATGAGGTCGAG -3’

A.2 Design of the probe

The probe aims to receive the target, by binding by perfect complementarity. It is made by :

Two restriction enzymes producing cohesives end, BmtI and BglII, which goal is to remove the little sequence in between on the bottom strand and thus create a perfect complementarity with the target. /li>

Two nicking enzymes, Nt.BspQ1 et Nb.bts1, i.e. enzymes that cut one strand of the double DNA strand. Thereby, the top strand is removed, allowing the binding of the target.

Probe :
5’-GAATTCAGAGCAAGTGCTCTTCACTTGGTTTAGATATGCACTGGCTAGCAGAGCAAGTAGATCTTTCGTAATGAGGTCGAGCACTGCTGAGCAAGTTCTAGA- 3’

A.3 Choice of the plasmid backbone

We chose a plasmid from the iGEM 2017 DNA distribution kit, following different conditions to screen. We wanted the plasmid to :

have a red fluorescent reporter: RFP or mCherry

be high level copy

be properly sequenced

have no restriction sites that were used for the probe

not be arabinose inducible (the first tests we did were not conclusive) so preference for IPTG induction

Finally, we chose BBa_J04450 as original backbone.This iGEM part enables users to produce the reporter mRFP1, a fluorophore which is an engineered mutant of red fluorescent protein from Discosoma striata. Its reporter is LacI sensitive and can be induced with IPTG.
Other fluorophores (GFP, YFP…) can be used if users insert the detector in other plasmid backbone (via EcoRI and XbaI digestion).

A.4 New part : BBa_K2299000

Then, the part we designed is made with two parts : the detector, i.e. the probe and the plasmid backbone, carrying a reporter.
To sum up, once the probe is activated/digested, a “window” is opened: a short part of the detector is single strand, allowing the ligation of the target by complementarity and then the recircularization of the plasmid, which can be transformed.